Lab 10 - Human Genetic Profile Analysis Using The Polymerase Chain Reaction, Cheat Sheet of Biology

Download Lab 10 - Human Genetic Profile Analysis Using The Polymerase Chain Reaction and more Cheat Sheet Biology in PDF only on Docsity!

Lab10-PCR

Lab10-PCR

Wednesday, November 16, 2022 10:19 PM

LAB 10 HUMAN GENETIC PROFILE ANALYSIS USING THE POLYMERASE CHAIN REACTION (PCR) [this lab was modified from the Michigan State University Molecular Biology Lab Manual] une. LS hita Katore vte_I2-/-22 INTRODUCTION Each human somatic cell (any cell other than a sperm or egg cell) nucleus contains 46 chromosomes, These chromosomes are made up of 6.4 billion base pairs of DNA that encode over 30,000 genes. Only a small portion of a cell's DNA encodes genes however, the majority of it is non-coding or "junk" DNA. About 1% of this non-coding DNA is composed of highly repetitive sequences called satellites. The repeat unit length of these satellites varies from one to several thousand base pairs and they may be present from 10 to 107 times on a chromosome. One type of repeat sequence is referred to as a VNTR (variable number of tandem repeats). VNTR loci are composed of blocks of a repeating DNA sequence (9 to 45 base pairs in length) and are polymorphic, meaning they have many forms. VNTR loci are so variable that it is unlikely that samples of DNA from two individuals (other than identical twins) would be identical. VNTR loci are therefore used to provide the basis for forensic identification, paternity testing and population analyses. One VNTR locus, D1$80, (Kasai et al.1991), is analyzed in this lab exercise. This locus is composed of repeating units of 16 nucleotide long segments of non-coding DNA. The number of repeats varies from one individual to the next, and ranges from 14 to over 40 repeats. D1S80 is located on chromosome 1, and is inherited from your mother and father. As shown in Figure 1, a person can be heterozygous (the maternal and paternal chromosomes have different numbers of repeats) or homozygous (the maternal and paternal chromosomes have the same number of repeats). There are 29 known D1$80 alleles with differing number of repeats. In this laboratory exercise, you will determine the number of D1S80 alleles present in your DNA. Determining the number of repeats requires three general steps: 1. Obtain a sample of cheek cell DNA. Several thousand cheek cells are obtained by scraping the inside of your cheek with a sterile toothpick. The cells are collected by centrifugation and resuspended ina solution containing the resin Chelex. Chelex binds metal ions that inhibit the PCR reaction. The cells are lysed to release the DNA by boiling them and then centrifuged to remove cell debris and Chelex resin. The supernatant contains the cheek cell DNA. 2. Make copies of specific D1S80 DNA from the sample using polymerase chain reaction (PCR). In this process, cheek cell DNA is mixed with small pieces of DNA called primers that bind just upstream and just downstream of the D1$80 locus (see Figure 1). The enzyme Taq DNA polymerase then replicates (makes an exact copy of) the D1S80 locus by adding nucleotides (adenine, thymine, Lab 10-1 10. 11. 12. 13. 14. Wear gloves while you perform this procedure so as not to introduce nuclease enzymes from your hands into the sample. Vigorously scrape the inside of the cheek with a toothpick. Break off the top half of the toothpick and place the bottom part in a clean 1.5 ml microcentrifuge tube and add 1000 ul of H20. Vigorously vortex the sample for 20 seconds. Remove the toothpick using forceps and discard it in the trash (not on you desk, because that would be gross!). Spin your cell sample in a microcentrifuge for 45 seconds at 14,800 rpm (be sure to balance with another person). Remove 970 il H2O and discard it down the sink without disturbing your cell pellet. Don’t remove the entire 970 ul sample if there is a danger of sucking up your pellet! Add 200 pl of 5% (w/v) Chelex to the sample using the p1000 pipettor with a pipette tip whose end has been cut off with a scissors to make a wider bore. This will prevent the pipette tip from becoming clogged. Chelex beads contain EDTA which removes metal ions thus inactivating any nucleases that may be present. | > mexah Vortex the sample for 10 seconds. Shelton Aun ud ‘by te wt quig ‘neha akills prota Add 2 ul of ProteinaseK to the sample and vortex for just a few seconds to agitate. Proteinase K will destroy any proteins present, especially nucleases, Incubate your tube at 56 °C for 5 minutes to allow the proteinase K to work. Vortex the sample for 10 seconds. Insert your microfuge tube in the special blue rack that goes over and seals the cap of the microfuge tube. This will prevent the caps of the microfuge tubes from popping in the boiling water bath. Incubate the tube in a boiling water bath for 8 minutes. This treatment will further denature and destroy all proteins and will also open up the cell membranes and nuclear envelopes to release the DNA. Be sure someone in the lab is designated to watch over the tubes to make sure they will not pop open. Vortex the sample for 10 seconds. Spin in a microcentrifuge at 14,800 rpm for 3 minutes. There should be two distinct layers visible in the reaction tube at the completion of step 12. The bottom layer contains the 5% Chelex and extraneous cellular matter, while the top layer contains an aqueous solution of DNA. The sample is now ready for PCR amplification. Lab 10-3 PART B. PCR AMPLIFICATION OF THE D1S80 VNTR LOCUS Materials 0.2 mIPCR tubes (Research Products Intl.) “ DNA thermal cycler “ PCR master mix as a desiccated pellet inside the PCR tube: ® dNTP mix * Taq DNA polymerase ® PCR buffer » MgCl, which is needed by taq polymerase Primer mix consisting of: upstream primer LOM1 (sequence: 5' gaaactggcctccaaacactgcccgccg 3') + downstream primer LOM2 (sequence: 5' gtcttgttggagatgcacgtgccccttge 3') “ Micropipettors + tips 1. Obtain a small PCR tube, that contains a dehydrated white master mix pellet (a sphere), and a larger PCR tube that is empty. These PCR tubes look like regular microfuge tubes but are smaller. Label both tubes with your initials on the cap and on the sides. This will be hard for the smaller tube, but do it right. You have to be able to ID your tube next week. 2. Transfer the white pellet from the small PCR tube into the larger PCR tube. Save the small PCR tube for use later. 3. Add 22.5 ul of the primer mix to the large PCR tube that contains the dehydrated pellet. Allow the primer mix and pellet to sit for a minute and then use the pipettor set to about 20 il to pipette the solution up and down several times to dissolve the pellet. 4. Add 2.5 pl of the supernatant from your DNA sample (from step 14 on previous page) to the PCR tube and pipette up and down to mix. 5. Centrifuge the tubes for 15 seconds to pool the reaction mixture. 6. Set your pipettor to 25 ul and transfer the contents of the larger PCR tube back into the smaller PCR tube. 7. Now place the small PCR tube into a thermal cycling machine programmed to run 30 cycles with the following parameters. a. Denaturation 94 °C for 30 sec. b. Annealing 65 °C for 30 sec. c. Extension 72 °C for 30 sec. d. Finalizing period at the end at 72 °C for 10 min. Completed reactions may be stored at -20 °C indefinitely. PART C. OBSERVING DNA USING AGAROSE GEL ELECTROPHORESIS To separate your amplified D1S80 fragments, you will place them in an agarose gel and apply an electrical current. Since DNA is negatively charged at neutral pH (due to its phosphate backbone) it will Lab 10-4 2- bonds —> Neterozzaena \- band — Nom 0 4gona( Stones ntpeats 6. Remove the tape and the gel casting dams and comb and enough 1X TBE buffer to just cover the top. wA DIM of the gel (adding too much buffer will dilute the current running through the gel. The surface of the , gel should be covered with 1 to 2 mm of buffer. dad. Loading and Running your gel: 1. Your instructor will pipet 10 pl of the DNA molecular weight standard (pBR322 plasmid DNA that was cut with BstNI restriction enzyme) into the first well of the gel. The DNA sizes of the molecular weight standard are as follows: 1857 bp, 1058 bp, 929 bp, 383 bp, and 121 bp (this last one will be faint on the gel). You will use this standard to determine the sizes of the DNA bands. ; No tp Aistomes Av A. 2. Load 20 ul of your PCR sample into the yolir designated well. Be sure to write down the order of all the student samples in your notebook. 3. Close the lid of the gel box and connect the apparatus to a power supply. ‘e of the power supply to 100 volts rode wires in the ge it is properly connected. 5. Electrophorese the DNA until the red dye from the loading dye in the primer mix reaches half-way down the gel (approximately 45 min to 1 hour). 6. Put on gloves. Unplug the power cord. Disconnect the gel from the power supply and lift the gel tray from the electrophoresis box. 7. Slide the gel off the gel tray and place it in a staining tray (a weigh boat). And stain with SYBRSafe stain solution for at least one hour (or more if time permits) in the dark (in a drawer), followed by one rinse with tap water. 8. Pour the electrophoresis buffer back into the container from where you got it. 9. View the gel under ultraviolet light. CAUTION: UV can damage the retina, ALWAYS wear safety glasses!! 10. Wipe off the transilluminator with ethanol. 11. Dispose of the gel as directed. 12. Rinse out the electrophoresis apparatus with tap water followed by distilled water and place it upside down to dry. Interpretation: 1. Orient the photograph of your gel with the sample wells towards the top. Amplified DNA will appear as bands. Lab 10-6 a. If you see one band, you may be homozygous for the D1S80 locus or the two loci may be almost the same size and cannot be separated by the agarose gel system. b. If you see two bands, you are heterozygous at the D1$80 locus. c. If three or more bands are visible, the two brightest bands are most likely the true alleles. Additional bands may result from the primers binding non-specifically and amplifying other loci. d. Adiffuse bright layer at the end of the gel is probably composed of primer dimers (primers that bind to each other and self-amplify). RESULTS 1. Calculate the sizes of the fragments in your PCR sample. If no fragments are visible in your sample lane, calculate the sizes of the fragments in your partner's lane. a. Orient your gel photo with the wells at the top. Working from the bottom to top, assign base pair sizes to the first 5 bands that appear in the DNA size ladder marker: 1857 bp, 1058 bp, 929 bp, 383 bp, and 121 bp b. Measure the distance (in mm) that each DNA marker fragment migrated from the sample well. Measure from the front edge of the well to the front edge of each band. c. Linear DNA migrates in an agarose gel at a rate that is inversely proportional to the log of its size in base pairs. Therefore, plotting the distance migrated on the Y-axis versus the log of the fragment size on the X-axis will yield a line that can be used as a standard curve to determine the size of other DNA molecules. d. Draw a best-fit line through the points on the graph, e. Measure the distance (in mm) that each sample band migrated. Use your graph to determine the size in bp of each band. PLEASE TAPE OR PAST A PICTURE OF YOUR GEL IN THE SPACE BELOW (MARK WHICH LANE CONTAINS YOUR DNA). Lab 10-7 Lab 10-8 Gel Electrophoresis Standard Curve 140 120 BR 2 5 oo" = -49.049x + 216.66" Distance(mm) N b nD oo oO Oo Oo Oo lo} 0 0.5 1 1.5 2 25 3 log10 base pairs Te fiahabom pois (CVS 2 bond] 35 1106 pe 9l-2\ 2 Ke eeew2ra = 271027 10 = SIH b 4S P 2-S418 Foo ee BAe 214.229 2.541.910 = 353 bp. 2 -4q.15 6. Draw an actual PCR process up to TWO cycles using the template DNA and primers shown below. The wavy line in the middle is the region to be amplified. The primers are as shown as the highlighted sequences. ALWAYS show the target region to be amplified as a wavy line and non target DNA as a straight line (as shown below). ALWAYS highlight the primers that ae binding to the DNA on either side of the target DNA (do this at the end after you are sure that everything is correct), BE CLEAN, NEAT, AND CLEAR in your answer. | have to be able to see things clearly to give you credit. Use a pencil and an eraser to minimize messiness. Prime |ARGET REGION TO BE AMPLIFIED DAAALAAALSZSCEGC —_—_\_ 5° 3) TAAT, —________ 3’ Primer: 94°C | denatine 6s°e | anneal WC elongate 3s TART WARD G ¢cq —_3 ce qacs' avr aA ' 3s au°c 6s"c q2"c ' cs' ATTA NOS C4 ; 3 s TAAT ee ee ae) 3 ATTA ROTO CQancs Lab 10-10