Download (MB) ASCP Comprehensive Practice Exam Questions with Reviewed Answers and more Exams Molecular biology in PDF only on Docsity!
(MB) ASCP Comprehensive Practice Exam
Questions with Reviewed Answers
A cerebrospinal fluid (CSF) sample for hematologic evaluation should be tested within how many hours of collection? 1 hour 2 hours 3 hours 4 hours ✓1 hour A DNA specimen was sent to your Molecular Diagnostics Laboratory for DNA sequencing, in order to determine whether patient A has a particular mutation in gene X. The gene sequence is known. However, the gene mutation itself is not known. Therefore, DNA sequencing cannot be performed on this DNA specimen. (True or False) True False ✓True A parent has an autosomal dominant disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% ✓50% A parent has an autosomal recessive disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50%
A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a single-gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntingtin gene. Which of these methods would best accomplish this task? Methylation-specific PCR Standard PCR PFGE RAPD PCR ✓Standard PCR A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a single-gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntington gene. Testing with standard PCR indicates that patient has Huntington Disease, HD. Which of the following would be consistent with this diagnosis? 25 CAG repeats in the Huntington gene 85 CAG repeats in the Huntington gene 25 CGA repeats in the Huntington gene 85 CGA repeats in the Huntington gene ✓85 CAG repeats in the Huntington gene A reverse dot blot is best performed by: -Immobilizing multiple unlabeled probes onto the membrane and then allowing one labeled sample to hybridize to the unlabeled probes -Immobilizing one labeled probe onto the membrane and allowing multiple labeled samples to hybridize to the labeled probe -Immobilizing multiple unlabeled probes onto the membrane and allowing multiple unlabeled samples to hybridize to the unlabeled probes
Only A ✓A or G Acute promyelocytic leukemia (APL) is responsible for what translocation? ✓t(15;17) After an amplification procedure followed by gel electrophoresis, you took a photo of your gel. You notice consistent bands in all your gel lanes. However, you also see what appears to be a faint but noticeable band in your reagent blank lane. What is your best explanation for the reagent blank band? -Taq polymerase concentration was too low in this PCR reaction -There was obvious contamination in this PCR reaction -The primers concentration was too high in this PCR reaction -The dNTPs concentration was too high in this PCR reaction ✓There was obvious contamination in this PCR reaction All of the following are components of nucleic acids, EXCEPT: Phosphate group Sugar (ribose or deoxyribose) Nitrogenous base (A, G, C, T) Formamide ✓Formamide All of the following are liquid tumors, except: Mantle cell lymphoma Ewing sarcoma Burkitt's lymphoma Acute promyelocytic leukemia ✓Ewing sarcoma
All of the following are trinucleotide repeat disorders, EXCEPT: Spinocerebellar Ataxia Type 8 Huntington Disease Asperger Disease Fragile X Disease ✓Asperger Disease All of the following enzymes are part of the DNA replication machinery, EXCEPT: Ligase DNA polymerase Luciferase Helicase ✓Luciferase All of the following methods of amplification are considered target amplification, except: Quantitative PCR NASBA Strand Displacement Amplification Reverse Transcriptase PCR ✓NASBA As a technologist working in a small clinical laboratory, a nasal swab specimen, suspected to be colonized by a variety of upper respiratory viruses, came to your laboratory. You are tasked with determining whether the specimen is colonized with rhinovirus, coronavirus, and influenza. Which PCR method would best be suitable for this task? Nested PCR Real-time PCR NASBA Multiplex PCR ✓Multiplex PCR
Clinical laboratories must have clearly written protocols in place describing handling of specimens for clinical testing. Many factors can affect testing performance before the actual testing is conducted. Such factors or variables are collectively known as pre-analytical. From the list below, select all the pre-analytical variables that can have a negative impact on clinical testing (Hint: more than one answer choice!) -Storage conditions -Patient identifiers -Anticoagulant in collection tubes -Transport procedures -Introduction of Heparin in all blood tubes to maintain specimen integrity for testing -Thermo cycling parameters -DNA isolation method used -Testing analysis software used ✓-Storage conditions -Patient identifiers -Anticoagulant in collection tubes -Transport procedures Codons that code for the same amino acid are called: Synonyms Similar Degenerates Complements ✓Synonyms
Consider a hypothetical mutation involving gene X. Let's say you amplify a specific exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person without the mutation, cutting the gene with restriction enzyme W generates two fragments of sizes, 100 bp and 250 bp. Suppose a C>T mutation in gene X deletes a restriction site, yielding a fragment of 350 bp. You would expect a heterozygous person for gene X to have these fragments on a restriction gel: +/+ = 350 bp; 250 bp; 100 bp; m/+ = Only the 350 bp m/+ = 350 bp; 250 bp; 100 bp m/m = 350 bp; 250 bp ✓m/+ = 350 bp; 250 bp; 100 bp Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? 60°C 58°C 64°C 62°C ✓ 58 °C Deletion in the paternal chromosome 15: del(15)(q11q13) results in Prader-willi syndrome. However, deletion in the same region in the maternal chromosome results in a completely different condition known as Angelman syndrome. This phenomenon is an example of: Mosaicism Loss of heterozygosity Hemizygosity Genomic imprinting ✓Genomic imprinting During DNA replication, the 3' -OH of the growing DNA chain attacks which phosphate of an incoming nucleotide? Alpha Beta
How many hydrogen bonds are formed between one C:G base pair? 1 2 3 4 ✓ 3 How many log10 reductions in HIV viral load is considered to be successful upon treatment? 0.5log 1log 2log 3log10 ✓0.5log How many polymorphisms can be found in the human genome? Approximately 10 million Approximately 100 thousand Approximately 1 billion Approximately 1 million ✓Approximately 10 million If a woman is infected with the HPV virus, which of the following parameters increases her risk of developing cervical cancer? A vegetarian diet Never having been pregnant Obesity Smoking ✓Smoking If two parents are heterozygous for an autosomal recessive disease, then their offspring will most likely follow this gene frequency pattern:
-25% homozygous dominant, 50% heterozygous, and 25% homozygous recessive -50% homozygous dominant, and 50% homozygous recessive -100% homozygous for the dominant phenotype -100% homozygous for the recessive phenotype ✓25% homozygous dominant, 50% heterozygous, and 25% homozygous recessive Imagine you are working in specimen processing for the molecular laboratory and you receive a patient's specimen collected in a lavender top vacutainer tube containing EDTA. The test that is ordered requires that the specimen be collected in a yellow top ACD vacutainer tube. What is the BEST action to take in this instance? -Reject the specimen, inform the supervisor and request a new specimen drawn in ACD -Process the sample according to laboratory protocol because EDTA does not interfere with molecular testing methods -Document the tube additive change, process the sample, run the test, and hold the results until a supervisor or laboratory director signs off -Follow the prescribed laboratory protocol for accepting and rejecting specimens -Both B & D are correct -Both C & D are correct ✓-Follow the prescribed laboratory protocol for accepting and rejecting specimens In a retrovirus the RNA acts as: Genome and mRNA mRNA Genome rRNA ✓Genome and mRNA In CML, what fusion protein is created?
Klenow fragment of DNA polymerase Okazaki fragments Sanger fragments RNA fragments ✓Okazaki fragments Mantle cell lymphoma (MCL) is caused by what translocation? ✓t(11;14) Mutation in this gene (Xp21) is associated with Duchenne Muscular Dystrophy: Dystrophin P Musculin C-myc ✓Dystrophin Mutation in UGT1A1 affects metabolism of what drug? ✓Ironotecan Mutation in what gene is associated with Fragile X syndrome? ✓FMR Mutations in the CFTR gene is associated with what disease? Fragile X Cystic Fibrosis Sickle-cell anemia Mantle Cell Lymphoma ✓Cystic Fibrosis Next Generation Sequencing set-up require: Library preparation and extensive bioinformatics analysis BAC clones Use of translation factors Hybridization ✓Library preparation and extensive bioinformatics analysis
Next Generation Sequencing uses: ✓Short sequence reads Nucleic acid hybridization methods can be affected by a host of factors. Select all the factors that that can influence this process. G:C ratio of bases pH of the hybridization reaction Hybridization temperature All of the above ✓All of the above Primer dimers are due to what complimentary issue? 3' to 3' complementarity of primer pairs 3' to 5' complementarity of primer pairs 5' to 5' complementarity of primer pairs 5' to 3' complementarity of primer pairs ✓3' to 3' complementarity of primer pairs Purines and pyrimidines differ from each other in that: ✓Purines have two rings; pyrimidines have one ring Replication forks, known as origins of DNA replication, are created by this enzyme: Ligase Taq Polymerase Primase Helicase ✓Helicase RT-PCR can be used to quantify messenger RNA (mRNA) among other uses. All of the following concerning RT-PCR are true, EXCEPT: RT-PCR is useful in detecting RNA-viruses, such as HIV
Testing for Aldehyde Dehydrogenase deficiency is important in patients with: Alcohol dependence Diabetis Lactic acidosis Obesity ✓Alcohol dependence Testing for HOXB13, BRCA1 and BCRA2 is usually done in patients with: ✓Prostate cancer The 5' capping process creates what type of linkage? 5'-3' 3'-5' 5'-5' 3'-3' ✓5'-5' The amelogenin locus, found on the sex chromosomes, is used in gender identification. Amplification at this locus reveals 2 peaks of sizes 212 and 218 base pairs. If this amplification were part of a gender identification procedure, what would be the gender of the individual? Male Female Hermaphrodite Can't be determined from the given information ✓Male The hydroxyl group in a deoxyribonucleotide is expected to be found on which position of the sugar? C1' C2' C3'
C4' ✓C3'
The mother of a 3 year old boy took him to the doctor's office for concerns of an underlying genetic condition. A karyotype order was sent to the Molecular Diagnostic lab. Karyotype results show 47, XY,+21. Based on these results, the boy has: Patau Syndrome Down Syndrome Edward Syndrome Cri du chat Syndrome ✓Down Syndrome The nitrogenous base in a nucleotide is expected to be found on which position of the sugar? C1' C2' C3' C5' ✓C1' The phosphate group in a nucleotide is expected to be found on which position of the sugar? C1' C2' C4' C5' ✓C5' The phrase "central dogma of molecular biology" refers to the flow of genetic data in this manner: DNA --> RNA --> Proteins DNA -->Proteins --> Genes RNA --> DNA --> Proteins
Small Nuclear RNA (snRNA) MicroRNA (miRNA) ✓Transfer RNA (tRNA) This enzyme is known for "unzipping" genes! Alkaline Phosphatase RNA polymerase Apyrase Helicase ✓Helicase This enzyme is known for "unzipping" genes! Alkaline Phosphatase RNA polymerase Apyrase Helicase ✓Helicase This highly polymorphic loci region is crucial in assessing immune system compatibility: VNTRs HLA SINES SNPs ✓HLA This PCR method works by generating a signal at the annealing step (i.e. when the probe binds its target) of the PCR reaction: FRET probes Scorpion primers Molecular beacons Taqman ✓Molecular beacons
This polymerase acts on DNA and produces Messenger RNA: ✓RNA Pol II This polymerase acts on DNA and produces Ribosomal RNA: RNA Pol I DNA Pol I RNA Pol II DNA Pol II ✓RNA Pol I This polymerase acts on DNA and produces Transfer RNA: RNA Pol II DNA Pol II RNA Pol III DNA Pol III ✓RNA Pol III This polymerase is involved in "initiation of DNA replication and has primase activity": ✓Pol α This polymerase is involved in "replicates mitochondrial DNA": ✓Pol γ This polymerase is involved in "short-patch base excision repair": Pol α Pol β Pol γ Pol δ ✓Pol β This restriction enzyme "digests and adds a methyl group from Adenine": Type I Type II
