Docsity
Log inSign up
Docsity
Prepare for your exams
Prepare for your exams

Study with the several resources on Docsity

Earn points to download
Earn points to download

Earn points by helping other students or get them with a premium plan

Guidelines and tips
Guidelines and tips
Sell on Docsity
Sell on Docsity
Log inSign up

Prepare for your exams

Study with the several resources on Docsity

Find documents

Prepare for your exams with the study notes shared by other students like you on Docsity

Search Store documents

The best documents sold by students who completed their studies

Search through all study resources
Docsity AINEW

Summarize your documents, ask them questions, convert them into quizzes and concept maps

Explore questions

Clear up your doubts by reading the answers to questions asked by your fellow students

Earn points to download

Earn points by helping other students or get them with a premium plan

Share documents
download point icon20 Points

For each uploaded document

Answer questions
download point icon5 Points

For each given answer (max 1 per day)

All the ways to get free points
Get points immediately

Choose a premium plan with all the points you need

Study Opportunities

Choose your next study program

Get in touch with the best universities in the world. Search through thousands of universities and official partners

Community

Ask the community

Ask the community for help and clear up your study doubts

University Rankings

Discover the best universities in your country according to Docsity users

Free resources

Our save-the-student-ebooks!

Download our free guides on studying techniques, anxiety management strategies, and thesis advice from Docsity tutors

From our blog

Exams and Study
Go to the blog

Notes on Proteins, Translation - Biological Foundations for Physiology | BIOL 121, Study notes of Biology

Lansing Community CollegeBiology
Prof. Bradley J. Kassuba

5.3 Material Type: Notes; Professor: Kassuba; Class: Biol Foundation for Physiology; Subject: Biology; University: Lansing Community College;

Typology: Study notes

2011/2012

Uploaded on 04/11/2012

angelo-de-la-casa
angelo-de-la-casa 🇺🇸

4.4

(56)

508 documents

1 / 7

Toggle sidebar

This page cannot be seen from the preview

Don't miss anything!

bg1
pf3
pf4
pf5

Partial preview of the text

Download Notes on Proteins, Translation - Biological Foundations for Physiology | BIOL 121 and more Study notes Biology in PDF only on Docsity!

Biol 121 Lecture 5.3 — Proteins, Translation A. Read Chapter 11.2 8. Protein structure 1. Basic unit - Side chains determine - Changing an amino acid may - 2. Polypeptide — Reaction: 3. More complex levels of structure - C. Translation = using mRNA to build the polymer of amino acids (polypeptide} 1. Genetic code — pps Codan = aetcouon bes Practice: ean IE SB RNA, 3! mRNA y AUGGUUCCACGUUACGAGUAA 3° Divide into codons Look up codon Anti-codon 2. The beginning and the end — not ail of the mRNA gets translated Beginning = End = Practice — translate MRNA, beginning at start codon and ending at stop codon: